Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_20409

SGN-M19891

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71252)
Chromosome
12
Position
39.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67602)
Chromosome
12
Position
50.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56222)
Chromosome
12
Position
7.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGAGAGACCGGCCAGCATTGGGAACCAAAAATGCTCTGTGACGTCACAC
  
3' flanking region
TCTCATCTTCAGTAGTGTCAACTGGCTTCAGAGCACCACCAGGTATAAGA
SNP nucleotide
CG
SNPdb format
CAGAGAGACCGGCCAGCATTGGGAACCAAAAATGCTCTGTGACGTCACAC[C/G]
TCTCATCTTCAGTAGTGTCAACTGGCTTCAGAGCACCACCAGGTATAAGA
  
Genomic location of solcap_snp_sl_20409  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19891 marker 19891
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)