SGN Marker TG483

SGN-M199

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAATGGTAAATTTGTGTTAGAAATAGAGAAAACATTAATTGCTAGTATAACTTTGATCTGAAGTTTTCTTCTTTTCTTTTGTCCCTCCAC
TCCCATGGCAGATAAAAAATGGAATTATTGCAATAGCAGTGAAGGTAGGAATCTCCTAATCTGTGAGGTCTTTTTATTAGTGATTTCACA
TGTAAACATTATACATGTGGGATTCGTGATTTTTTTTGGTCACTCTATACGAGATCAATTGATGACTTGAGAACCCCTCAAAACACTAAA
CTCTATACTTCTGAATCTTTTCAGGTTGCTGCTATTGGACTGAACCCCTCAAAACACTTGGGAAAAGAGATAGCATACCTGGAGCCCCAT
CTCCACAAGCTAAAAGAGTATGATATGGTTAGCAAAAATTTTGGCTTTGTTTTACTTCACTTTTTTCGCATTTTTACGTCAATTTTTTTG
G
Reverse sequence
TGATTTTGAACTGCGCGCCACTGAATTTGAGGCGCGACGTCAGATGAGCATACCTCTTTAATCTATAACCTTGGTTTCAATCCTATTATT
ATGCCTCCGTGGTACTCCCATGAAATTTTACGCTGAGTGAATTAGGTGTGTGTGTATGAAAAGGAAAGAAATTGCAAAAAAGCGAAGTTG
TAACAAGGTGTAAAAAATAAATAAAAAAGTGAAAAGTAAAGATGTAAATAAGGAATAAAAAAAATAAAAAAGAGATGGAAGTAAGCCCAA
GATCTCTCTTGGGATTTACTTTTATCACTTGTTGGGTTTCTCGATTTACAACCAGACAAGAGCGCCGCGCCGCGCCATCGTCAGGCCGCT
CGCTTTTCACAGCCCTTTTCCAGTCACGCCGATAGTTCACGGGTGTCAGAATCCCCCTTCCTATTCAAGGCTGCCAAAGCTTGCATGGAA
AACCCAAAACTTACATTAATTTAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53337)
Chromosome
4
Position
22.13 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43871)
Chromosome
4
Position
34.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43613)
Chromosome
4
Position
18.20 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43333)
Chromosome
4
Position
37.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Pepper Capsicum   
Map version
65 (location: 42840)
Chromosome
5
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42475)
Chromosome
11
Position
123.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40875)
Chromosome
4
Position
25.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40062)
Chromosome
4
Position
22.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8559)
Chromosome
5
Position
82.24 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 8557)
Chromosome
11
Position
126.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8556)
Chromosome
4
Position
23.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8560)
Chromosome
4
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG483 was used as an overgo probe on plate 9 [well F10]

Plausible BAC Matches:   P153P07,   P156G23,   P313A13,   P024I01

 Overgo Sequences

A sequence
GCAATAGCAGTGAAGGTAGGAATC
B sequence
ACCTCACAGATTAGGAGATTCCTA
AB sequence
GCAATAGCAGTGAAGGTAGGAATCTCCTAA
Marker sequence
AAATGGTAAATTTGTGTTAGAAATAGAGAAAACATTAATTGCTAGTATAA
CTTTGATCTGAAGTTTTCTTCTTTTCTTTTGTCCCTCCACTCCCATGGCA
GATAAAAAATGGAATTATTGCAATAGCAGTGAAGGTAGGAATCTCCTAAT
CTGTGAGGTCTTTTTATTAGTGATTTCACATGTAAACATTATACATGTGG
GATTCGTGATTTTTTTTGGTCACTCTATACGAGATCAATTGATGACTTGA
GAACCCCTCAAAACACTAAACTCTATACTTCTGAATCTTTTCAGGTTGCT
GCTATTGGACTGAACCCCTCAAAACACTTGGGAAAAGAGATAGCATACCT
GGAGCCCCATCTCCACAAGCTAAAAGAGTATGATATGGTTAGCAAAAATT
TTGGCTTTGTTTTACTTCACTTTTTTCGCATTTTTACGTCAATTTTTTTG
G
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG483  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D199 marker 199
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)