SGN Marker solcap_snp_sl_20723

SGN-M19916

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71257)
Chromosome
3
Position
91.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67608)
Chromosome
3
Position
87.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63998)
Chromosome
3
Position
97.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56247)
Chromosome
3
Position
61.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAGAAGATTCAGGGCGTATGAACCTAAAGTAACCAAAGATGCTAATTC
  
3' flanking region
ACTGATGTTCGTAAGGCCCGGAAAGAACAGTTAAAGAGAGATGAGGCTGT
SNP nucleotide
CG
SNPdb format
AAAAGAAGATTCAGGGCGTATGAACCTAAAGTAACCAAAGATGCTAATTC[C/G]
ACTGATGTTCGTAAGGCCCGGAAAGAACAGTTAAAGAGAGATGAGGCTGT
  
Genomic location of solcap_snp_sl_20723  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19916 marker 19916
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)