SGN Marker T1422

SGN-M1994
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TPTAS72TH
Arabidopsis best BAC match: AB022217.1
Arabidopsis position: 3.0390000
Arabidopsis identities: 0.701
Best GenBank protein hit: BAB00078.1
Evalue: 5.9e-43
Identities: 0.622
Description: RING zinc finger protein-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49435)
Chromosome
1
Position
66.72 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47369)
Chromosome
1
Position
34.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39613)
Chromosome
1
Position
32.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1422 was used as an overgo probe on plate 8 [well G9]

Plausible BAC Matches:   P125K20,   P163B20

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACCGGATAATAACCGGGTTGAGGT
B sequence
GTTCACTGTTACTGCCACCTCAAC
AB sequence
ACCGGATAATAACCGGGTTGAGGTGGCAGT
Marker sequence
GTTCATTTGCATTATTTACCATGAATAACGATGCCCCAAGCATGATTCAT
GATCCATTGATTGATTCCACAGGAGATGGAGGCTATGCATTGAGTGGCAA
AATTATGCTAAGTGCTATTGTTATCTTATTCACTGTTGTTGTTTTCATGG
TGGGTCTTCATCTATATGCTCGTTGGTACCTTCTATCTCAGCGCCGTCGT
GAACTCCTTCGCCGCCGTAGGGTTAACCATAGACGGACTCATATTGTTTT
CTACGTTGATAATCCTGGTTCCGGTTTGTCTGATGCTAACCGGGGTTTGG
AACAGGCGGTTCTCAATTCCTTGCCGGTTTTTGTTTATTCCGACAAGACT
CACCCGGAACCGCTGGAATGTGCTGTTTGTTTATCGGAATTTGAGGAGAA
TGAAAAGGGTCGGGTTTTACCCAAGTGTAATCACTCTTTTCATTCCGAAT
GTATTGATATGTGGTTGCATTCCCATTCTACTTGCCCTCTATGTCGCTCT
CCGGTAGAAGCAGTACTTATCGAACCGGATAATAACCGGGTTGAGGTGGC
AGTAACAGTGAACGAACCGGGTTCGAGTT
Genomic location of T1422  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1994 marker 1994
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)