Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_20798

SGN-M19946

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56277)
Chromosome
3
Position
60.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCTCCGTGAATCAGGGGGATTGATATCCCCATTTTCCATAACATCAAA
  
3' flanking region
ATTGATTCTGTCGCTGTCGGTTGTTGAAAAGAGAAATTGGTCTTCCCATT
SNP nucleotide
AT
SNPdb format
GCCCTCCGTGAATCAGGGGGATTGATATCCCCATTTTCCATAACATCAAA[A/T]
ATTGATTCTGTCGCTGTCGGTTGTTGAAAAGAGAAATTGGTCTTCCCATT
  
Genomic location of solcap_snp_sl_20798  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19946 marker 19946
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)