SGN Marker T1424

SGN-M1995
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS87TH
Arabidopsis best BAC match: AB025641.1
Arabidopsis position: 5.0480000
Arabidopsis identities: 0.729
Best GenBank protein hit: BAB08929.1
Evalue: 1.7e-62
Identities: 0.668
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39614)
Chromosome
3
Position
74.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1424 was used as an overgo probe on plate 8 [well F6]

Plausible BAC Matches:   P127K18

 Overgo Sequences

A sequence
GAATTGTCGGATGGTGCTGTTAGG
B sequence
ACGGACGACATCTATGCCTAACAG
AB sequence
GAATTGTCGGATGGTGCTGTTAGGCATAGA
Marker sequence
GGTAATCTTCGTAACCCTATTCATCACTTCCCCAATCCCCAATCACTCTC
CGATTGGCTAAGGCCGCGTATGCCTTCTGATTCTTTTGCTTCGTGGGGTG
TTAAGCCGGGAACCAAGAATGTTAGTAATCTCTGGCTTGAGTTGTCTGAA
GGGGAGACTTTGCTGGCTGATTCTACGCCGCCGGTTCGAACTGTTGAGGT
TATGGTTGTTAAGGTTATTGGAAAAGACAATAAGGTCCTTGTTGAATCGC
ACCAAGAATTGTCGGATGGTGCTGTTAGGCATAGATGTCGTCCGTTGTCG
GAGAAGATGAAGCCTGGTGAGACAGTTGAAGATGCGGTTTTTCGTGCCGT
GAAAGAAGAGCTTGGTTCAGTGCTTGGTGGGTTTTTTGGTGAGCTCAGAG
AGAATGGCATTGTTAAGATTTTGCCCAATTCGTATTCGAAGAAGGTGGAG
GAAAGGGTTTCAGCGTCTTATCCTGGATTGCCTGCTTGTTATGTGTTGCA
TACAGTGGAGGCTGCAGTGGATGGTTTGCCTGAGGAGGAGTTTTGCACAG
AAGAGACTGATGAATATGGAGATTCTAGTGAGAGGATGGTCATAAATGGT
GCAGTTTCCTGT
Genomic location of T1424  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1995 marker 1995
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)