SGN Marker T1428

SGN-M1996
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAT13TH
Arabidopsis best BAC match: AC002505.2
Arabidopsis position: 2.1490000
Arabidopsis identities: 0.842
Best GenBank protein hit: AAC14506.1
Evalue: 3.9e-50
Identities: 0.610
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39615)
Chromosome
7
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1428 was used as an overgo probe on plate 7 [well D12]

Plausible BAC Matches:   P173A21

 Overgo Sequences

A sequence
TGGAGAATCAATGGGTTCTTCGTC
B sequence
GGGAAAAGTGTCCGTTGACGAAGA
AB sequence
TGGAGAATCAATGGGTTCTTCGTCAACGGA
Marker sequence
TGTCAATTGAGCAGCCCAACTCGGCGACGGCGACGGCGACGGGACAAGTT
GCCGGGTTTGCACAACTGTATGAATCTTCTCTCTCATCTGAGCACAGTGA
TACAGTGTTCTTTGTTTATACATTGGAGAATCAATGGGTTCTTCGTCAAC
GGACACTTTTCCCCAAATTCAGGAAACTTTGATGGAATTTCGTGCTGGTA
AAATGCTCATGGAGGGCAAAAAGGTTATCCCTGATTCACGGAAAGGACTT
GTTCGTATAGGCAGGGGTGAAGAGGGACTACTCCATTTTCAGTGGCTTGA
CCGTAATCTCAACATTGTTGAAGATGATCAGATTGTTTTCCCAGAGGAGG
CAGTCTTTGAGAAGGTCAATCAATCATCTGGAAGGGTTTACATTTTGAAG
TTCTGTACCGACGATAGAAGGCTTTTCTTTTGGATGCAGGAGCCAGCAGC
TGACAATGATGCACAGTTATGTAGCTCAGTCAACTTCTACTTGAATCAAC
CACTAGAGTTTCCTGTTGAAGATGAGCCTGAAGCTTCAGCTCCTTTACCA
AATTCTGAAGATATGGTAGAAGAAGATATTTCAT
Genomic location of T1428  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1996 marker 1996
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)