SGN Marker solcap_snp_sl_20952

SGN-M19969

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67622)
Chromosome
11
Position
27.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64012)
Chromosome
11
Position
32.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56300)
Chromosome
11
Position
3.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATCGTACGATGCTAGCTGCGATGCGGTAACTAGCATGGCGCGGTTCAC
  
3' flanking region
GTAAGAGATGAACCGCGCCACAGGCTAGTTACCCCTTCGCTTTTACTCAT
SNP nucleotide
CG
SNPdb format
TGATCGTACGATGCTAGCTGCGATGCGGTAACTAGCATGGCGCGGTTCAC[C/G]
GTAAGAGATGAACCGCGCCACAGGCTAGTTACCCCTTCGCTTTTACTCAT
  
Genomic location of solcap_snp_sl_20952  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19969 marker 19969
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)