SGN Marker T1429

SGN-M1997
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.01.01
Tomato EST read: TPTAT19TH
Arabidopsis best BAC match: AL132963.1
Arabidopsis position: 3.1142000
Arabidopsis identities: 0.764
Best GenBank protein hit: CAB44316.1
Evalue: 4e-112
Identities: 0.990
Description: serine palmitoyltransferase [Solanum tuberosum]
Comment: key enzyme in sphingolipid biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39616)
Chromosome
3
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1429 was used as an overgo probe on plate 9 [well G7]

Plausible BAC Matches:   P316D05,   P028B21,   P298P15,   P164J09,   P168M04,   P313G16,   P151N01,   P037B07,   P006O09

 Overgo Sequences

A sequence
GCAAGCCAGCTGCTATTGTCACAG
B sequence
GTTACGTAACCCATGCCTGTGACA
AB sequence
GCAAGCCAGCTGCTATTGTCACAGGCATGG
Marker sequence
GTATTCTGCGAGCACTTGCAGTGCCCGTGTTGATGGAGGTACCACAAGCA
TCCATATGGAATTGGAAGAATGTGTGGCTAATTTTGTTGGCAAGCCAGCT
GCTATTGTCACAGGCATGGGTTACGTAACAAATTCAGCCATACTTCCTGT
CTTGATCGGAAAGGGAGGTTTGATTATCAGTGATTCTCTCAACCACAACT
CTATTGTAAATGGTGCTCGAGGGTCTGGAGCTACTATTCGTGTTTTTCAA
CATAACACACCTTCTCACTTGGAGAAGGTTTTGAGAGAACTTATTGCTGA
GGGACAACCCAGAACACACAGGCCATGGAAGAAGATAATTGTTATAGTGG
AGGGCATATACAGCATGGAAGGGGAGCTATGTCAGCTTCCAGAGATTGTC
GCCATATGCAAGAAATACAAGGTATATGTTTACTTGGATGAGGCACACAG
CATTGGAGCTGTTGGAAAAACAGGAAGGGGAGTCTGTGAGCTCTTGGGAG
TTGACACAGCTGATGTGGACATTATGATGGGAACTTTCACAAAATCATTT
GGTTCATGCGGAGGTTATATTGCTGGATCTAAAGAACTTATTGAATATTT
GAAGTATT
Genomic location of T1429  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1997 marker 1997
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)