SGN Marker T1430

SGN-M1998
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAT22TH
Arabidopsis best BAC match: AC004218.2
Arabidopsis position: 2.2130000
Arabidopsis identities: 0.702
Best GenBank protein hit: AAC27833.1
Evalue: 3.6e-63
Identities: 0.662
Description: putative phospholipase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39617)
Chromosome
4
Position
23.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1430 was used as an overgo probe on plate 7 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGCTCCAATGTGTAAGATTGCAG
B sequence
TGTGGCCTCAGATCATCTGCAATC
AB sequence
TTGCTCCAATGTGTAAGATTGCAGATGATC
Marker sequence
GATTTTATATATATAGATAGAAATAGAATTTAGATATTATCTCTTCAAAT
AAATCCAAATATATACACTACTTACCAAATATTCTATTCATATAATATTA
ATAAATTCATTCTTACTCTACCTTTGCTGAATTAATTCATCATGGCTAAT
GAATATGAAACTGTTAGATATGAAGAGGAATTTATATTGAATTCAAGAGG
AATGAAATTATTTACATGTAGTTGGGTCCCAAAAGATTGTGAACCAAAAG
CTTTGATTTTCCTTTGTCATGGATATGCCATGGAGTGCAGTATATCAATG
AAAGATGCTGGAACGCGATTGGCGAAATCAGGATTTGGAGTTTATGGAAT
TGATTATGAAGGACATGGAAAATCAGAAGGACTTCAAGGATATGTTAATA
GCTTTGATGCTCTTGTTGATGATTGTTTTGATCATTATTCCAAAATTTCT
GAAAGGAAGGGAAAATAGAAAAAGATGAGAATATTAATGGGAGAATCGAT
GGGAGGAGCTGTGGCTCTACTTTTACACAGAAAAAAACCTGAATTTTGGG
ATGGTGCTGTTTTAATTGCTCCAATGTGTAAGATTGCAGATGATCTGAGG
CCACATCCAATGGTGATAAGTGTTTTGACCAAACTTTGCAACT
Genomic location of T1430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1998 marker 1998
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)