SGN Marker solcap_snp_sl_20982

SGN-M19987

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71279)
Chromosome
11
Position
26.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67631)
Chromosome
11
Position
28.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64021)
Chromosome
11
Position
33.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56318)
Chromosome
11
Position
3.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCCAAATTTCCCAATCAAAATGTGTTACGGCGGTCAACGATTACCGTC
  
3' flanking region
AAAGACGACTTAACCGACCCGACCCGACGGACCCGAACTTTACCGGCGGC
SNP nucleotide
AT
SNPdb format
ATTCCAAATTTCCCAATCAAAATGTGTTACGGCGGTCAACGATTACCGTC[A/T]
AAAGACGACTTAACCGACCCGACCCGACGGACCCGAACTTTACCGGCGGC
  
Genomic location of solcap_snp_sl_20982  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19987 marker 19987
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)