SGN Marker TG430

SGN-M20

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG430 image not available
Forward sequence
AGATCTTTCTAATTGAACTTCCTTTGCCTTCCCCCATATCTATCCTAATAATGTAACACTTTAATATCCATGAATACTATTCAAGTACTT
TGCAGCATTCAATGAGACATCACTAACCATAATGTGTCTAATACTAGAATGAAGGTGACGACGAAGAAGAGAGTGGAGAACCCTAAATTC
CCATGCTGACCCATTTTCTTCAATCCAAAATCATGAAAGAAATCATCCACCTTTATGCAGTATAAATGTGATCGAACGTTTACATTTTTA
CTCTCTGATTAAAAATGTAGCGCACGAAAGTTATTTTATTTTGGGAAGATGCAAGCAGCAGATAGGATGTCTTCGTTGCCACTTCAAGGA
ACCCCTGAGTGTGGCAGTTGCAGGGGTACTGGACCTTCTTTATTTTCTCTCTCTGTTAGTGTCCTTGTTGCTCCATTAGTACTCCAGCCG
GAATACTGCTGATAGTAGTTGTACATCACTTCTCTTTAGTATACTTGTGTTCTTGCTTACCATTTCGAGTCTGTCTTTAGCTAAACAACA
AAGATTTGTGTTTCCTTTCTTGATTTGCATAATTTTATCAAGTAATAATGGAATGTAAACTTCCATTCCATGTTGTT
Reverse sequence
GGTTCAATTATTGTATTCATAAAGTTTATTTGGTCTAAAGTGACTTTATTAAAACTATGGAATTAAGAAAATGTAGAGCTTGTGGGCTTT
AAGTGATGGCACACTCCCTGGAATTCTATAATCTTTGCCTTAGTATGTGGAGAGCACACTCCACCCTATTGTTATATACCAAAGGAAGTA
CGTCCCTTAGCTAAGTGTTAAACTATACAGCATCCATTGTCACAAGCCCCTCATGACTTCATTTCATGGTTCATAACATATTGTACC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53317)
Chromosome
1
Position
94.05 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53316)
Chromosome
1
Position
92.93 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7763)
Chromosome
11
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7762)
Chromosome
1
Position
103.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7764)
Chromosome
1
Position
63.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG430 was used as an overgo probe on plate 4 [well H9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGGGAAGATGCAAGCAGCAGATAG
B sequence
TGGCAACGAAGACATCCTATCTGC
AB sequence
TGGGAAGATGCAAGCAGCAGATAGGATGTC
Marker sequence
AGATCTTTCTAATTGAACTTCCTTTGCCTTCCCCCATATCTATCCTAATA
ATGTAACACTTTAATATCCATGAATACTATTCAAGTACTTTGCAGCATTC
AATGAGACATCACTAACCATAATGTGTCTAATACTAGAATGAAGGTGACG
ACGAAGAAGAGAGTGGAGAACCCTAAATTCCCATGCTGACCCATTTTCTT
CAATCCAAAATCATGAAAGAAATCATCCACCTTTATGCAGTATAAATGTG
ATCGAACGTTTACATTTTTACTCTCTGATTAAAAATGTAGCGCACGAAAG
TTATTTTATTTTGGGAAGATGCAAGCAGCAGATAGGATGTCTTCGTTGCC
ACTTCAAGGAACCCCTGAGTGTGGCAGTTGCAGGGGTACTGGACCTTCTT
TATTTTCTCTCTCTGTTAGTGTCCTTGTTGCTCCATTAGTACTCCAGCCG
GAATACTGCTGATAGTAGTTGTACATCACTTCTCTTTAGTATACTTGTGT
TCTTGCTTACCATTTCGAGTCTGTCTTTAGCTAAACAACAAAGATTTGTG
TTTCCTTTCTTGATTTGCATAATTTTATCAAGTAATAATGGAATGTAAAC
TTCCATTCCATGTTGTT
Genomic location of TG430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20 marker 20
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)