SGN Marker solcap_snp_sl_21034

SGN-M20029

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56360)
Chromosome
11
Position
4.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTAGATGTTTCCCATAAGCCAGCAAGAGGTACCAAGAAAAAATGAATAG
  
3' flanking region
AGGTTCAGTATCACATTCTAAACCGCTGGATGATTCTGAATCATAATTTG
SNP nucleotide
TC
SNPdb format
CTTAGATGTTTCCCATAAGCCAGCAAGAGGTACCAAGAAAAAATGAATAG[T/C]
AGGTTCAGTATCACATTCTAAACCGCTGGATGATTCTGAATCATAATTTG
  
Genomic location of solcap_snp_sl_21034  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20029 marker 20029
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)