SGN Marker solcap_snp_sl_21113

SGN-M20068

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67663)
Chromosome
11
Position
34.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56399)
Chromosome
11
Position
4.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACCATATAGATAAATTTGGCAACACACCTCTGCTTGAAGCAATCAAGA
  
3' flanking region
TGGACATGATCGCGTTGCTTCATTACTTGTTAAGGAAGGGGCCTTATTGA
SNP nucleotide
TG
SNPdb format
TCACCATATAGATAAATTTGGCAACACACCTCTGCTTGAAGCAATCAAGA[T/G]
TGGACATGATCGCGTTGCTTCATTACTTGTTAAGGAAGGGGCCTTATTGA
  
Genomic location of solcap_snp_sl_21113  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20068 marker 20068
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)