Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1447

SGN-M2008
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAT77TH
Arabidopsis best BAC match: AB019230.1
Arabidopsis position: 3.0470000
Arabidopsis identities: 0.755
Best GenBank protein hit: BAB02717.1
Evalue: 7.3e-59
Identities: 0.755
Description: aldose 1-epimerase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39623)
Chromosome
3
Position
140.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39624)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1447 was used as an overgo probe on plate 2 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTGGCCGTGATATCCAGCAGGTT
B sequence
GGTCATACCATAAGCCAACCTGCT
AB sequence
ATTGGCCGTGATATCCAGCAGGTTGGCTTA
Marker sequence
GTTGATCAGTACACGGTCCCAACTGGAGAAATAATGCCTGTTAAAGGCAC
TCCATTTGATTTCACCTCTGAAAAGCAGATTGGCCGTGATATCCAGCAGG
TTGGCTTATGGTATGACCATAATTATGTGCTAGACTGTGGAGACAAGAAA
GATGGCTTGAAGCATGCTGCAAAAATCAAGGATCCTAAGAGTTCCAGAGT
ACTTGATTTATGGACCAATGCTCCTGGCATGCAGTTTTACACTGCAAACT
ATGTCGATGGAGTTGTTGGCAAAGGTGGAGCTGTTTATAACAAGCATGCT
GGAGTCTGTTTAGAGACTCAAGGATTTCCAAATGCTATCAACACACCAAA
TTTTCCCTCTATTGTCGTTCAGCCTGGTGACAAGTACATACACAATATGG
TGTATGAATTTTCAGTTGAATAGATTGTTTTAGGATTTCTTCTACACCAA
AATGAACCAGTAACGGTACTTCTGTTTAGCTTGTTAGTTCTGTGTCCTAT
TTGCAACCAATAAAGGTACACTTCTTCAAGATGAAAAACCTTGGTAGTAT
GAGTTGTGAGTATCAGTAG
Genomic location of T1447  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2008 marker 2008
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)