SGN Marker solcap_snp_sl_21216

SGN-M20084

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71307)
Chromosome
3
Position
3.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67670)
Chromosome
3
Position
12.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56415)
Chromosome
3
Position
1.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGATCTCGGAGAGGATGATTTTCTCCTTGAATCTGTGCTTCCATTGTT
  
3' flanking region
TAAATTGGTATGACCGCGTTTTGAGTACCTTCAATCATGTAATCTATTGC
SNP nucleotide
AG
SNPdb format
GTAGATCTCGGAGAGGATGATTTTCTCCTTGAATCTGTGCTTCCATTGTT[A/G]
TAAATTGGTATGACCGCGTTTTGAGTACCTTCAATCATGTAATCTATTGC
  
Genomic location of solcap_snp_sl_21216  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20084 marker 20084
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)