SGN Marker solcap_snp_sl_21385

SGN-M20121

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71322)
Chromosome
4
Position
23.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64074)
Chromosome
4
Position
33.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56452)
Chromosome
4
Position
3.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCCGGCGACCGGAGAATCCTACGCCTGTAAATCTATCGATAAAAACCT
  
3' flanking region
CTCATTGATTCCACCGACCGTGAGTGTCTCGATAAAGAACCCAAAATTCT
SNP nucleotide
TC
SNPdb format
TCTCCGGCGACCGGAGAATCCTACGCCTGTAAATCTATCGATAAAAACCT[T/C]
CTCATTGATTCCACCGACCGTGAGTGTCTCGATAAAGAACCCAAAATTCT
  
Genomic location of solcap_snp_sl_21385  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20121 marker 20121
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)