SGN Marker solcap_snp_sl_21430

SGN-M20128

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71326)
Chromosome
8
Position
53.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67689)
Chromosome
8
Position
42.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56459)
Chromosome
8
Position
57.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGAGGAATGTAATATGGAAATAAGTTGTACTTACATTTTTTCGCCATC
  
3' flanking region
CGTTTTTGCGGTTTTTACAGAGATAATGGTGTTGTTTCAGGTGAATATCT
SNP nucleotide
AG
SNPdb format
AGAGAGGAATGTAATATGGAAATAAGTTGTACTTACATTTTTTCGCCATC[A/G]
CGTTTTTGCGGTTTTTACAGAGATAATGGTGTTGTTTCAGGTGAATATCT
  
Genomic location of solcap_snp_sl_21430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20128 marker 20128
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)