SGN Marker solcap_snp_sl_21779

SGN-M20168

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56499)
Chromosome
11
Position
2.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGAGTTACTGGAGCTGTACGTGCAACATAAACAGCGCCATTATCAGTA
  
3' flanking region
TACCACTTCCATTACTACTCGCTATAACATTTACCGGCAAAACATTTTTA
SNP nucleotide
AC
SNPdb format
AAGGAGTTACTGGAGCTGTACGTGCAACATAAACAGCGCCATTATCAGTA[A/C]
TACCACTTCCATTACTACTCGCTATAACATTTACCGGCAAAACATTTTTA
  
Genomic location of solcap_snp_sl_21779  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20168 marker 20168
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)