SGN Marker solcap_snp_sl_2178

SGN-M20169

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71345)
Chromosome
4
Position
50.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67706)
Chromosome
4
Position
60.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64097)
Chromosome
4
Position
80.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56500)
Chromosome
4
Position
55.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCCACAAATTCCTGAGCCTTTTTGTTTTGTGTTACTTTTTGGTTCAGT
  
3' flanking region
TTATTTCTTAGGGGGTTGGTTCACCATTTTAACTTATTTGTTGTTGTATT
SNP nucleotide
CG
SNPdb format
ATTCCACAAATTCCTGAGCCTTTTTGTTTTGTGTTACTTTTTGGTTCAGT[C/G]
TTATTTCTTAGGGGGTTGGTTCACCATTTTAACTTATTTGTTGTTGTATT
  
Genomic location of solcap_snp_sl_2178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20169 marker 20169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)