SGN Marker solcap_snp_sl_21829

SGN-M20177

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71352)
Chromosome
11
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67709)
Chromosome
11
Position
1.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64099)
Chromosome
11
Position
3.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56508)
Chromosome
11
Position
0.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTTGTCTTGAATCTTAGCTTTGACATTATCAATGGTGTCAGAACTCTC
  
3' flanking region
ACCTCAAGAGTGATGGTCTTTCCGGTGAGTGTCTTAACAAATATCTGCAT
SNP nucleotide
AG
SNPdb format
TCCTTGTCTTGAATCTTAGCTTTGACATTATCAATGGTGTCAGAACTCTC[A/G]
ACCTCAAGAGTGATGGTCTTTCCGGTGAGTGTCTTAACAAATATCTGCAT
  
Genomic location of solcap_snp_sl_21829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20177 marker 20177
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)