Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_21966

SGN-M20193

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64105)
Chromosome
2
Position
150.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56524)
Chromosome
2
Position
48.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGCGAAAATTGGGAAGGAATCATTACTAGAATTTGGCCAAACACAAAG
  
3' flanking region
ACCTTGATGTGATAGTCACAGGTGCAATGGCTCAATATATACCTACTTTG
SNP nucleotide
TC
SNPdb format
AAGGCGAAAATTGGGAAGGAATCATTACTAGAATTTGGCCAAACACAAAG[T/C]
ACCTTGATGTGATAGTCACAGGTGCAATGGCTCAATATATACCTACTTTG
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_21966  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20193 marker 20193
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)