SGN Marker TG125

SGN-M202

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATTACAGTAGTTGTGAAGAGTCTTACAGATTGACTGAGACAGGGGAGCTCCATGTACCACCTGAATATACCGATCAATACTGCAAAGGA
CCCTGCTTGGAGGAGACTCACCATGTGCTTAATTGTCTTGGAAGCATACTGTCGCAGTTCAGATTTTATAATAAAGCCACCGTCAGAGCA
GTCGAAGAGACTATCAAGGAGGGATGTAGCTATGGCCCTGAAAGAGGTTAAACTTTCTCCACTTCACTATACAAAACTGTCCAGTATATT
TGTTCTGTTGATAAACTTATTGGATATGATTAATTTGTTTCGAGTTGGGAGTACGTTTAAAGAAACAAATCTTTAATTTATATACATTGA
CAGTACACTATTCAATGTGTTTGGATCTTCTTGTCTCTTTATCGAAACTGAACTCATTCTGAAATATGTCAACAGGTCTTTTCAATGTTG
CTGAGCACATCCTAGCTTATGACAACACTGCTTTTCGTGCTTCAAAATCGTCCATGCT
Reverse sequence
CATCCCTGGCCTCCTCTTTGATTTTGCCCCTCTGAAAATTGAAGGGTGTCCTTCTTTTCTGTAGTCTGTCATCTTAGTAATGTTGAGATA
AACAACTGGTGTCTTCATTTCTGATATTACTGATTCAAGAACTCTCATCATCCATGGATATGGACCTAATTGAGTCTCGTTTGTTATCGG
TTTCGTCTCCCCATCACAGTTTCCTCCTGAGTTCCATTGACCACCTCTGCAAAAAAGGGAATTCCCCTCATTAGCCTATCAAACAACAAG
GGGTCTGGAGAAGGTAGGGCGTACGCAAATGAGAGATTGTTTCCGAAAGATCCTCAAAAATTATAAGAATGAAGAAAGCATAGCGGTTAA
AAGGAGTCAGTAGACTATCGAAAAAAGAGAAGTTTTACTTGAAATGAGAAGCTGAATATCCCCTAAAAAACACTCTAGTTTTGGTGCTGT
TGATAGTTGTATCAACCCAATGTGCCCATGTCTTCAATGCCTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53511)
Chromosome
1
Position
26.45 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53167)
Chromosome
1
Position
39.55 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43829)
Chromosome
1
Position
22.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43580)
Chromosome
1
Position
15.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43289)
Chromosome
1
Position
33.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40831)
Chromosome
1
Position
41.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39897)
Chromosome
1
Position
31.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8565)
Chromosome
1
Position
18.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8568)
Chromosome
1
Position
15.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8567)
Chromosome
1
Position
46.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG125 was used as an overgo probe on plate 5 [well H6]

Plausible BAC Matches:   P187N20,   P048O19,   P021C06,   P235D03,   P137O23,   P235D02,   P216G16,   P147B05,   P123N06

 Overgo Sequences

A sequence
GAGACTATCAAGGAGGGATGTAGC
B sequence
CTCTTTCAGGGCCATAGCTACATC
AB sequence
GAGACTATCAAGGAGGGATGTAGCTATGGC
Marker sequence
CATTACAGTAGTTGTGAAGAGTCTTACAGATTGACTGAGACAGGGGAGCT
CCATGTACCACCTGAATATACCGATCAATACTGCAAAGGACCCTGCTTGG
AGGAGACTCACCATGTGCTTAATTGTCTTGGAAGCATACTGTCGCAGTTC
AGATTTTATAATAAAGCCACCGTCAGAGCAGTCGAAGAGACTATCAAGGA
GGGATGTAGCTATGGCCCTGAAAGAGGTTAAACTTTCTCCACTTCACTAT
ACAAAACTGTCCAGTATATTTGTTCTGTTGATAAACTTATTGGATATGAT
TAATTTGTTTCGAGTTGGGAGTACGTTTAAAGAAACAAATCTTTAATTTA
TATACATTGACAGTACACTATTCAATGTGTTTGGATCTTCTTGTCTCTTT
ATCGAAACTGAACTCATTCTGAAATATGTCAACAGGTCTTTTCAATGTTG
CTGAGCACATCCTAGCTTATGACAACACTGCTTTTCGTGCTTCAAAATCG
TCCATGCT
Genomic location of TG125  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D202 marker 202
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)