SGN Marker T1462

SGN-M2020
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAU60TH
Arabidopsis best BAC match: AL132964.2
Arabidopsis position: 3.1145000
Arabidopsis identities: 0.630
Best GenBank protein hit: CAB62468.1
Evalue: 3.2e-22
Identities: 0.671
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39630)
Chromosome
6
Position
69.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1462 was used as an overgo probe on plate 5 [well A2]

Plausible BAC Matches:   P191G12

 Overgo Sequences

A sequence
ACCCTGAAGGAAATGATAACACAC
B sequence
GCCCAAGGGAAGAATAGTGTGTTA
AB sequence
ACCCTGAAGGAAATGATAACACACTATTCT
Marker sequence
GGAGCCATGTGGAATGCTTCTATTTTCTCTTCTGAGGGAAAAACACCATG
GGAAGATGTCAAAAGAGAGTATGTGAGAAAGAGTATATTGTGGGATAATG
ATATCAAAAGTACAAAGCACACCCTGAAGGAAATGATAACACACTATTCT
TCCCTTGGGCGCCCGGAGGGGCTGGCAGTAATTAAATCAAATACCTTGGC
AGATCTGGCGTAAGTTTTTATATCTTCTGCCGTTACTTCCACCCGTGGTT
ACATGTGTTGGGATCAAATTTAGTTGCTGTTCAGTTAGTTTCCAAATTAA
GTTGTTCATGTTCTGATAATGTATGACATCTGCTTCACCTCATCCCCTTG
CTTGTTTTTTTTTACATAATTGCGTAGTCTGCTCATTCTAAAAGCTACTC
AAAAGTTTGACTCAGTAAAAACGAGGATTTATATTGTGAAAAGGTGCATG
AGGTTCTTAATCTTCTCTTTCATCCTTGTATTATTCACTTTGAGATTTGT
CCAACATTGGCAGAGTCCATAAGTCCACAACCTTTACTATTATCATTGTT
ACAACTCTTCACATATAAGCTGTCGATGGATATAACTAGCCAATTAACTA
TGATTGGACTAATTAGTTGTCGAGGCCCTTGCTGGTCTGGTTAGTGCTAT
ATTTG
Genomic location of T1462  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2020 marker 2020
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)