SGN Marker T1471

SGN-M2025
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAV20TH
Arabidopsis best BAC match: AC003040.2
Arabidopsis position: 2.1340000
Arabidopsis identities: 0.688
Best GenBank protein hit: AAC23754.1
Evalue: 3.1e-62
Identities: 0.734
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39631)
Chromosome
1
Position
127.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1471 was used as an overgo probe on plate 9 [well A8]

Plausible BAC Matches:   P048B10,   P318E23,   P332J16,   P005K16,   P226A22,   P214P13,   P261D11,   P002D16,   P164M23,   P322L15

 Overgo Sequences

A sequence
GCACTTCCTTCTTCACCGTTTCTG
B sequence
AGAAAGGAACATGGCCCAGAAACG
AB sequence
GCACTTCCTTCTTCACCGTTTCTGGGCCAT
Marker sequence
GTACAGGGGCACTTCCTTCTTCACCGTTTCTGGGCCATGTTCCTTTCTAC
CTTGGGAAATCTTCATCTACGCACTTTACCCACAATTCGGTGTGTATTTT
CAAAGTAAAAGCACTGTTTTGGGGTTCAAGAAGAAGTGTAAAGCCTGCTG
ACAAGGTTCTTTCGCTTGGGGAATTCACTTCATCAGAGGCGGATTCACTG
GGAACTGGCTGGATTCCACAACACATCATTGCTGAGGATGCAAGTAAAAA
TATTTTAGGTGTTGTTCCTCTCTATCTCAAAAGCCATTCCTATGGTGAAT
ATGTATTCGATAATTCTTGGGCAAATGCCTATTACAATTATGGTTTGAGC
TATTACCCAAAGCTGCAATGCTCAGTGCCTTTCACTCCAGTTACAGGCCC
AAGGATCTTGGTCCGCAACACTTCACATAGAGATCAAGTTTTTGACATCC
TAGTCTCTGCAATGAAGGATTTGGCAGCCAAGTTTAACGTTTCATCTCTA
CATATTACTTTTCCAACTTCAAATGAGTGGAACAAGTTGGAGGAGAAAGG
TTTTCTGCAAAGGACCGGAATGCAGTATCATTGGAAAAATCGTAATTATA
AAAACTTTGATGAGTTTTTGATGGACATGAAGCAGAGCAAGAGG
Genomic location of T1471  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2025 marker 2025
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)