SGN Marker TG128

SGN-M203

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTTCCAGATTATTCAACACAAGTATCATCAGTACCCTTTCAAAAGGACAAGCCTTAAAAATCATTCATAGACTGTTGTTTTCCGCTTCAC
CAAAACCAAGTGATTTATAAGTTCCACCTAAGGAAAGTTTGTAGCCCTTCCCCACTAAGGTCCCCAAGATAACAGCCACGAAGGAAATCA
ACATGCACAGACAAAGCCACAACCTTAACTTAGGTAGCTGAGAATAAACTACTGCATTATTGTGCTTCAGCTGGAAACTATGCAACATTG
ACTCTTACCTGGGCAACTTTTGAGCACTTGCTGAGGACTTACTCTACTAAGCTGCAAATTCTGGAGTCATTTGCCACCATTGGGTTGGAT
TAGTACATTCAGAAAGAGTATCCTCATCCCAACTGCCATACTGTATCTAAGTGTTAAAAACAACAATGATTGATTTTCGAGACTAACATT
ATTTCAAGGGCACGTACAGATCAGAGGCCTAAAGCCACTACAGTACTAAGAGTGCA
Reverse sequence
CTTCCAGATTATTCAACACAAGTATCATCAGTACCCTTTCAAAAGGACAAGCCTTAAAAATCATTCATAGACTGTTGTTTTCCGCTTCAC
CAAAACCAAGTGATTTATAAGTTCCACCTAAGGAAAGTTTGTAGCCCTTCCCCACTAAGGTCCCCAAGATAACAGCCACGAAGGAAATCA
ACATGCACAGACAAAGCCACAACCTTAACTTAGGTAGCTGAGAATAAACTACTGCATTATTGTGCTTCAGCTGGAAACTATGCAACATTG
ACTCTTACCTGGGCAACTTTTGAGCACTTGCTGAGGACTTACTCTACTAAGCTGCAAATTCTGGAGTCATTTGCCACCATTGGGTTGGAT
TAGTACATTCAGAAAGAGTATCCTCATCCCAACTGCCATACTGTATCTAAGTGTTAAAAACAACAATGATTGATTTTCGAGACTAACATT
ATTTCAAGGGCACGTACAGATCAGAGGCCTAAAGCCACTACAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1540363.7e-45151 (29.8% of RFLP seq)+
SGN-U1540363.6e-45151 (30.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53512)
Chromosome
7
Position
65.74 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53169)
Chromosome
7
Position
24.42 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39899)
Chromosome
7
Position
43.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8569)
Chromosome
7
Position
47.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8574)
Chromosome
7
Position
37.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8573)
Chromosome
7
Position
85.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG128 was used as an overgo probe on plate 1 [well D4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTTTGTAGCCCTTCCCCACTAAG
B sequence
CTGTTATCTTGGGGACCTTAGTGG
AB sequence
AGTTTGTAGCCCTTCCCCACTAAGGTCCCC
Marker sequence
CTTCCAGATTATTCAACACAAGTATCATCAGTACCCTTTCAAAAGGACAA
GCCTTAAAAATCATTCATAGACTGTTGTTTTCCGCTTCACCAAAACCAAG
TGATTTATAAGTTCCACCTAAGGAAAGTTTGTAGCCCTTCCCCACTAAGG
TCCCCAAGATAACAGCCACGAAGGAAATCAACATGCACAGACAAAGCCAC
AACCTTAACTTAGGTAGCTGAGAATAAACTACTGCATTATTGTGCTTCAG
CTGGAAACTATGCAACATTGACTCTTACCTGGGCAACTTTTGAGCACTTG
CTGAGGACTTACTCTACTAAGCTGCAAATTCTGGAGTCATTTGCCACCAT
TGGGTTGGATTAGTACATTCAGAAAGAGTATCCTCATCCCAACTGCCATA
CTGTATCTAAGTGTTAAAAACAACAATGATTGATTTTCGAGACTAACATT
ATTTCAAGGGCACGTACAGATCAGAGGCCTAAAGCCACTACAGTACTAAG
AGTGCA
Genomic location of TG128  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D203 marker 203
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)