SGN Marker T1480

SGN-M2032
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TPTAV57TH
Arabidopsis best BAC match: AL391143.1
Arabidopsis position: 5.0226000
Arabidopsis identities: 0.935
Best GenBank protein hit: CAC01744.1
Evalue: 2.6e-97
Identities: 0.903
Description: clpB heat shock protein-like [Arabidopsis thaliana]
Comment: protease from procaryotic origin
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42385)
Chromosome
2
Position
97.70 cM
Confidence
I
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43843
Forward primer (5'-3')
ACCACCTTGGATGAATACCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAACAGCTTTTCCCTCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39634)
Chromosome
2
Position
106.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13980
Forward primer (5'-3')
ACCACCTTGGATGAATACCG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCAACAGCTTTTCCCTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 13980
Forward primer (5'-3')
ACCACCTTGGATGAATACCG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCAACAGCTTTTCCCTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 14088
Forward primer (5'-3')
ACCACCTTGGATGAATACCG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 450
Solanum pimpinellifolium LA1589: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCAACAGCTTTTCCCTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Solanum lycopersicum LA925: 550
Approximate temperature
50°C
  
PCR data   Exp. ID 32
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T1480 was used as an overgo probe on plate 11 [well A10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P315B10,   P193A22,   P172G12

 Overgo Sequences

A sequence
TGACCAGCCTACAGTTGAAGACAC
B sequence
GCGAAGTATGGAGACAGTGTCTTC
AB sequence
TGACCAGCCTACAGTTGAAGACACTGTCTC
Marker sequence
GACCACCTTGGATGAATACCGTAAATATATTGAGAAAGATCCTGCCCTGG
AGCGTCGTTTCCAGCAAGTTTATGTTGACCAGCCTACAGTTGAAGACACT
GTCTCCATACTTCGCGGATTACGTGAAAGATATGAGCTACATCACGGGGT
TCGCATTTCAGACACTGCGCTTGTCGACGCAGCTATTCTTTCGGACCGTT
ATATTAGTGGACGTTTTCTACCTGACAAAGCTATTGACCTAGTTGATGAA
GCTGCTGCAAAACTGAAAATGGAGATCACCTCAAAACCTACAGCCCTTGA
CGAGATCAATCGTGCAGTTTTGAAGTTGGAGATGGAGAGGCTATCTCTAA
CTAATGATACAGATAGAGCATCGAAAGACCGGGTAAACCGTCTTGAGACT
GAGTTGTCTCTTTTGAAGGAGAGGCAAGCTGAGCTGAACTTAAGTACGGG
AGTCTAAACACCTTGCAGCGTCAACTTGAAGCTTCAGAAAAAGAACTGAG
TGATTATATGAAGTCTGGAAAATCGATGCTCAGAGAAGAAGTAACTGGGA
ATGATATTGCAGAGATTGTCAGTAAGTGGACTGGGATTCCTGTTTCTAAG
CTACAACAGTCGGAGAGGGAAAAGCTGTTGCATTTAGA
Genomic location of T1480  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2032 marker 2032
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)