Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1483

SGN-M2035
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TPTAV76TH
Arabidopsis best BAC match: AB025624.1
Arabidopsis position: 3.0540000
Arabidopsis identities: 0.613
Best GenBank protein hit: AAD48496.1
Evalue: 4e-108
Identities: 0.981
Description: cysteine protease TDI-65 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49443)
Chromosome
12
Position
62.39 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47377)
Chromosome
12
Position
79.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39637)
Chromosome
12
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1483 was used as an overgo probe on plate 4 [well A10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTACGACGAGACACATATTCACCG
B sequence
TTCATCGTCGGTACGACGGTGAAT
AB sequence
CTACGACGAGACACATATTCACCGTCGTAC
Marker sequence
TAATATCAACCAATCATGGCAGCTCACAGCTCAACTCTCACCATATCCAT
ACTTCTCATGCTCATCTTCTCCACTTTATCCTCTGCTTCCGATATGTCAA
TTATTAGCTACGACGAGACACATATTCACCGTCGTACCGACGATGAAGTC
TCGGCGTTGTACGAGTCCTGGCTAATCGAGCACGGAAAATCGTACAACGC
CTTAGGAGAAAAGGATAAGAGATTTCAGATCTTCAAGGATAACTTGAAAT
ACATAGACGAACAGAACTCTGTTCCGAATCAGAGTTATAAGCTCGGATTG
ACGAAATTCGCCGATCTGACTAATGAGGAATACAGGTCGATTTACTTGGG
AACGAAGAGTTCCGGTGACCGGAAAAAGTTATCGAAGAACAAAAGTGATC
GGTATCTTCCTAAAGTTGGGGATAGCTTGCCGGAATCAATTGACTGGAGA
GAAAAAGGTGTGCTTGTTGGTGTCAAGGATCAAGGAAGCTGTGGGAGTTG
TTGGGCATTCTCTGCTGTTGCTGCCATGGAATCAATAAACGCGATAGTCA
CTGAGAATTTGATATCACTATCAGAGCAAGAGTTGGTGGATTGTGATAAG
TCGTACAATGAAAGTTGCGATGGTGGTCTTATGGACTACGCCTTTGAATT
CGTCATCAAGAATGG
Genomic location of T1483  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2035 marker 2035
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)