SGN Marker solcap_snp_sl_22934

SGN-M20363

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71407)
Chromosome
6
Position
1.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67775)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64163)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56694)
Chromosome
6
Position
0.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGTTGTGAGTTACGAAAACATTTCTGCAAGTCCTAAGCCTGGATTCAG
  
3' flanking region
AGGAGAGTTGCAGTAGATTGACAACCGGTGTAAAAGCTAATTAAGTTACG
SNP nucleotide
AG
SNPdb format
AATGTTGTGAGTTACGAAAACATTTCTGCAAGTCCTAAGCCTGGATTCAG[A/G]
AGGAGAGTTGCAGTAGATTGACAACCGGTGTAAAAGCTAATTAAGTTACG
  
Genomic location of solcap_snp_sl_22934  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20363 marker 20363
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)