Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1487

SGN-M2039
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW09TH
Arabidopsis best BAC match: AC006053.2
Arabidopsis position: 2.1450000
Arabidopsis identities: 0.972
Best GenBank protein hit: AAD31360.1
Evalue: 4.9e-57
Identities: 0.884
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39639)
Chromosome
12
Position
24.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1487 was used as an overgo probe on plate 1 [well E8]

Plausible BAC Matches:   P206G16,   P168I17,   P152O01,   P260C13,   P120D13,   P155P13

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAAAGCTGTTGACCAGTTGCATCC
B sequence
GAGGTATAGTGCACCTGGATGCAA
AB sequence
GAAAGCTGTTGACCAGTTGCATCCAGGTGC
Marker sequence
GCAGCTTAGTTATCATCCAGATGTCACTAAACAGCTTTGTCGTCATCCTT
TCCAGTTCCATTCAAAGAGAGGAATGCACAGCAGAAATAAGAAGGCAATG
GAGTTCATAGCTAAAGGGTGGAATGCTCTGCAGGAAGTTGATAGAGTAAT
TGATTATTGTGAGCTTAATGACAAACGTCTCATTCCTCCACTAAGGCAAA
GGAGAATTTTGAGTTGGCCCTAGAAGCAGACAACTCAAATACGCATGCAA
GATATTGGCTTTCAAAACTTCATCTCAAGTACCATGTCCCTGGGGCATGC
AAAGCTGTAGGAGCTGCTTTATTGGTTGAAGCTGCAGAAATGGGTGATCC
AGAAGCTCAATTTGAATTAGGTTGCCGTTTAAGAGTCGAGAACGAGTATG
TGCAATCAGATCAGCAAGCATTTTACTACTTGGAGAAAGCTGTTGACCAG
TTGCATCCAGGTGCACTATACCTCTTGGGTGCTGTGTATCTTACTGGGGA
CTGCGTG
Genomic location of T1487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2039 marker 2039
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)