SGN Marker T1488

SGN-M2040
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW10TH
Arabidopsis best BAC match: AL162651.1
Arabidopsis position: 3.3000000
Arabidopsis identities: 0.753
Best GenBank protein hit: CAB83127.1
Evalue: 1.5e-41
Identities: 0.617
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49444)
Chromosome
1
Position
81.43 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47378)
Chromosome
1
Position
103.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39640)
Chromosome
1
Position
109.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1488 was used as an overgo probe on plate 3 [well D2]

Plausible BAC Matches:   P012H24,   P148J07,   P111J23,   P073I22,   P051C14

 Overgo Sequences

A sequence
GGTTCCGGATCTACAACTGTGATC
B sequence
AAAATCTCACGGAGCGGATCACAG
AB sequence
GGTTCCGGATCTACAACTGTGATCCGCTCC
Marker sequence
CCGCCGTTCTCCACCCTACCTCATGACCTCTACCATCTCTGCCTCCTCCC
CTTGGCCCGAAAGCCCTTTCGTTTCCCCTCCTATGTCGGAAAATTCTCCT
GATTCCGGTGATCGTTCCTCTCTCTCTGACCTCTCCGATATCTCAGCTGC
CGTAACAGACGTCGTTGATGATGAACGCGGCTCTCAAACCTCGGTTACCT
CTCCCACTAATGCACCCGCCACTAGCGTACAGAACGTGAACCCTAGCCCT
AATTCTATTTCTCTTCCCGTTGATTCATCTACTCCGAATGTCCTTTACCT
ATCCTTCAACCAGGATTACGGATGCTTCGCGGCAGGCACCGATCGAGGGT
TCCGGATCTACAACTGTGATCCGCTCCGTGAGATTTTCCGCCGCGATTTT
ACCGGCAATTCTAATGGTGGAGGTGGAATTGGCGTTGTTCAGATGCTTTT
TCGGTGCAATATTTTGGCGTTGGTTGGTGGAGGTCCGGAGCCTCAATATC
CCTTAAATAAGGTGATGATATGGGATGATCATCAATCTAGGTGCATCGGC
GAGCTATCGTTTCGATCTGAGGTGAAATCTGTGAGGCTGAAAA
Genomic location of T1488  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2040 marker 2040
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)