SGN Marker T1494

SGN-M2045
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW52TH
Arabidopsis best BAC match: AB011474.1
Arabidopsis position: 5.2950000
Arabidopsis identities: 0.575
Best GenBank protein hit: BAB10408.1
Evalue: 2.6e-31
Identities: 0.467
Description: contains similarity to myosin heavy chain~gene_id:K2A18.10 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39644)
Chromosome
2
Position
80.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35605
Forward primer (5'-3')
GACTGAAGTTTGTGGCGAAGG
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 450+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTGAATTGGCTGCTGCTA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 31
Forward primer (5'-3')
Unknown
Digested band sizes (using CfoI)
Solanum pennellii LA716: 450+600
Solanum lycopersicum LA925: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1494 was used as an overgo probe on plate 12 [well H8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAACTTTCGGACAGAGATGAAGC
B sequence
CTCTGTAGCACGAAGAGCTTCATC
AB sequence
GGAACTTTCGGACAGAGATGAAGCTCTTCG
Marker sequence
GAGGGATAGAGCCCTTCAAGATCTAAAGAGCACCTTAATTAATCATGAGA
AGGAACTTTCGGACAGAGATGAAGCTCTTCGTGCTACAGAGCAACGGATC
AGAAGCATGGAAATGAAGTTCAATTCTGCTATTTCTGCGCACCAAAAAGA
GAAGGAAGCATGGGAAATAAGCCTTCAAAATGTAGAAGAAACATGGCGAT
TGAAATGTGATGCATTTAAAGCAGAGAGTGTGGTTACCTCTGGTGATAAT
GTTCAAAAAGAACTAGATGACCTCAAACAAAGCTGTAAAAAACTGAAGGA
AGAGCTTGATTCTTTTCGTGACCTTGCTGATAAGATGATTGAGGAGAAGG
ACAATGAAATCTCTAGACTTCTAGACGATAACGAGAACCTTCGCCACAAA
CTTCAGTCTGAATTTTTAGCCGATCGCAATGGCAATTCCAATACAGTATA
TGACAAGCAGGATCCTCTGAATTCGACTACCTCAGCTGCTGATCAGCAGA
TTCTGGTCTTGGCGAGACAACAAGCACAAAGAGAAGAAGAGCTTGCTCAG
TCACAACGTCACATTCTAGCCCTTCAAGAGGAGATAGAAGAGCTCGAACG
TGAAAATCGTCT
Genomic location of T1494  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2045 marker 2045
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)