SGN Marker T1499

SGN-M2047
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.22
Tomato EST read: TPTAW78TH
Arabidopsis best BAC match: AC005679.1
Arabidopsis position: 1.1498000
Arabidopsis identities: 0.903
Best GenBank protein hit: AAA33139.1
Evalue: 4e-109
Identities: 0.975
Description: vacuolar H+-ATPase [Daucus carota]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49445)
Chromosome
12
Position
47.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47379)
Chromosome
12
Position
63.75 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39646)
Chromosome
12
Position
66.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1499 was used as an overgo probe on plate 4 [well H3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTCAGACTTGGCCTGTACGTTCTC
B sequence
GATGCTACAGGTCTAGGAGAACGT
AB sequence
TTCAGACTTGGCCTGTACGTTCTCCTAGAC
Marker sequence
GCATTGCTCCAGCTGGTCAATACTCTTTGAATGATACTGTTCTTGAGCTC
GAGTTTCAAGGAGTCAAAAAGCAAGTGACTATGCTTCAGACTTGGCCTGT
ACGTTCTCCTAGACCTGTAGCATCAAAGTTAGCTGCTGATACTCCTCTTC
TTACCGGACAGCGTGTTCTCGATGCCCTGTTTCCCTCAGTGCTTGGTGGA
ACTTGTGCCATACCTGGTGCATTTGGCTGTGGTAAGACTGTGATTAGTCA
AGCTCTTTCCAAGTACTCTAATTCGGATACTGTCGTGTATGTTGGTTGTG
GGGAACGAGGGAATGAAATGGCAGAGGTACTTATGGATTTCCCTCAATTG
ACAATGACATTGCCTGATGGGCGTGAAGAGTCTGTCATGAAACGTACTAC
ACTAGTCGCTAATACTTCAAACATGCCTGTGGCTGCTCGTGAGGCCTCAA
TCTATACAGGTATTACTATAGCAGAATACTTCACAGACATGGGATACAAT
GTCAGTATGATGGCAGATTCTACCTCTCGCTGGGCCGAAGCTTTACGTGA
AATCTCAGGTCGATTGGCAGAAATGCCTGCAGACAGTGGATATCCTGCTT
ATTTGGCA
Genomic location of T1499  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2047 marker 2047
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)