SGN Marker solcap_snp_sl_23195

SGN-M20474

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56805)
Chromosome
3
Position
8.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATTTTGAGAGTAAAAAAAAGCTCAACAGATTCCTCTCTTCTCCAAAGC
  
3' flanking region
TTGCATTACATCAACTGTAGTGAAGGAAGGAAGGTAATGGATCATCAACA
SNP nucleotide
AG
SNPdb format
ATATTTTGAGAGTAAAAAAAAGCTCAACAGATTCCTCTCTTCTCCAAAGC[A/G]
TTGCATTACATCAACTGTAGTGAAGGAAGGAAGGTAATGGATCATCAACA
  
Genomic location of solcap_snp_sl_23195  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20474 marker 20474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)