SGN Marker T1500

SGN-M2048
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAW90TH
Arabidopsis best BAC match: AB019235.1
Arabidopsis position: 5.2700000
Arabidopsis identities: 0.523
Best GenBank protein hit: AAF77578.1
Evalue: 1.9e-69
Identities: 0.670
Description: pepper esterase [Capsicum annuum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49446)
Chromosome
6
Position
21.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47380)
Chromosome
6
Position
11.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39647)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1500 was used as an overgo probe on plate 3 [well C2]

Plausible BAC Matches:   P060B05,   P126J09,   P149O24,   P155K06,   P013J19

 Overgo Sequences

A sequence
GTTTTGCCAGGCACTTGCTGAAAG
B sequence
CACCATAGCACCAACTCTTTCAGC
AB sequence
GTTTTGCCAGGCACTTGCTGAAAGAGTTGG
Marker sequence
GACAATCCTTTTCTTAAGATTCAAGAATTACCAGGTAACACAGTTAAACG
TAACTCTGAATCCCTCAAACAAGCCAATTGTGATCCAAAAGGCACATCAT
TAGTCGTAACAAGGGATGTTGATCTTGACACAGCAGAAAACACTTGGCTG
CGACTATACGTCCCAAGACGTTTGACAAAAAATCCAAATCCTAAGAAATT
GCCACTGATTATGTACTATCACGGGGGAGGCTTTGTTTATTTCCATGCCA
ATACTTTTATATTCGATGTGTTTTGCCAGGCACTTGCTGAAAGAGTTGGT
GCTATGGTGATTTCACTTGAATATCGTCTAGCCCCTGAACATCGCCTTCC
TGCTGCTTATGATGATGCTATGGATGGGTTAGAATGGCTTAAGAATACCA
AGGATGAATGGGTTTGTAATTATGCTGATTTGAGTAAAGTTTTTCTTGGT
GGAACTAGTTCTGGAGGAAATTTAGCTTATAATGCAAGGCTACGTGCGGC
AGGGATGGCAAAAGAGCTAGAGCCAATAAAGATCAAAGGGTTACTATTAC
ATCATCCA
Genomic location of T1500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2048 marker 2048
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)