SGN Marker T1501

SGN-M2049
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAW91TH
Arabidopsis best BAC match: AC007267.4
Arabidopsis position: 2.0900000
Arabidopsis identities: 0.731
Best GenBank protein hit: AAD26904.1
Evalue: 9.6e-34
Identities: 0.489
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39648)
Chromosome
1
Position
149.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1501 was used as an overgo probe on plate 8 [well G1]

Plausible BAC Matches:   P015J24,   P003P15,   P168A23,   P263K01,   P241M08

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGAACAGAATCTTGGCTTCTGCTC
B sequence
AAGGGTGAAGAAACAGGAGCAGAA
AB sequence
GGAACAGAATCTTGGCTTCTGCTCCTGTTT
Marker sequence
GGTAATTTTCGAACAACACTAGCTATGCAAACTTTACTCTTGCCGGCGGT
TCGCCCCGGCATCGGAAGTGCGCCATTAGTTCATCCACCGGCCGGAAAAC
CATGGCGGAGTAGTTTCCTCCGATGCCCAAATACCCTAATTTCGTCCACC
TCATCGTTACCTTTTTCCCCTTTGAAAACAGATCCTCTTAGTTCGCCTCT
ATTCAGACTCATCAGCAAAAGGAACAGAATCTTGGCTTCTGCTCCTGTTT
CTTCACCCTTCACTTCTCCAAATGAAGAGTCCGAAAAAGCTAAGTTAGCT
CAGGTTGCCAAAAGACTACTGAATACTGCAAGTTACTTCAAGAGATTGGG
TACTCTAGGATTTTGGGGACAGCTTGTATGTACGCTTGTTGCTGCGGTGA
TCCTTTCGTTTTCCATTGCAATTACGGGCAGGATTACATCGCCCTTCACA
TTCTACTCAACTGCAGGCGGAATTGCAGCTGCTTTCATTTCAGATTTCTG
GTCATTTGGCTATCTTCAGTTGTCTGAAAAGCTTCGAAAGACA
Genomic location of T1501  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2049 marker 2049
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)