SGN Marker solcap_snp_sl_23469

SGN-M20498

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71432)
Chromosome
4
Position
48.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67829)
Chromosome
4
Position
59.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64217)
Chromosome
4
Position
75.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56829)
Chromosome
4
Position
54.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTATGTTGTAGTATTTTTCCCCCGACTTGATATCCAATGCATAAGGATCG
  
3' flanking region
ATGAAGCAACAATCCACATATCTTTTATTCCCATAGTTGTCTTTAAATAT
SNP nucleotide
CG
SNPdb format
GTATGTTGTAGTATTTTTCCCCCGACTTGATATCCAATGCATAAGGATCG[C/G]
ATGAAGCAACAATCCACATATCTTTTATTCCCATAGTTGTCTTTAAATAT
  
Genomic location of solcap_snp_sl_23469  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20498 marker 20498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)