Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_23471

SGN-M20500

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71434)
Chromosome
4
Position
48.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67830)
Chromosome
4
Position
59.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64218)
Chromosome
4
Position
75.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56831)
Chromosome
4
Position
54.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTATGTATGCAACCGAGTCTAGCAGCACAGACAGTTATGATCCAAAGTAT
  
3' flanking region
TGCTAGAATCACCTTCACCTTCTGAAGAACTTTTAAACACATCACCTACA
SNP nucleotide
TC
SNPdb format
TTATGTATGCAACCGAGTCTAGCAGCACAGACAGTTATGATCCAAAGTAT[T/C]
TGCTAGAATCACCTTCACCTTCTGAAGAACTTTTAAACACATCACCTACA
  
Genomic location of solcap_snp_sl_23471  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20500 marker 20500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)