SGN Marker solcap_snp_sl_23495

SGN-M20506

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56837)
Chromosome
12
Position
1.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATACCATATAAACAAGCTTGGAGAGCCAAGGAAAGAGGGCTGCAAGCTA
  
3' flanking region
ATATGGATCTTCCGAAGAAGGGTACTGTCTATTACCTGCATATTGTGAGC
SNP nucleotide
TG
SNPdb format
TATACCATATAAACAAGCTTGGAGAGCCAAGGAAAGAGGGCTGCAAGCTA[T/G]
ATATGGATCTTCCGAAGAAGGGTACTGTCTATTACCTGCATATTGTGAGC
  
Genomic location of solcap_snp_sl_23495  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20506 marker 20506
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)