Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_23559

SGN-M20511

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56842)
Chromosome
4
Position
59.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGTAGTGACTCCCCAAGTGAGTCCATCTTGTCGATAATAGATGTAAAC
  
3' flanking region
TGCTATGCATCTCCTGAATAGTTTCACCATCTTTCATCTTAAATAGTTCG
SNP nucleotide
AC
SNPdb format
TTGGTAGTGACTCCCCAAGTGAGTCCATCTTGTCGATAATAGATGTAAAC[A/C]
TGCTATGCATCTCCTGAATAGTTTCACCATCTTTCATCTTAAATAGTTCG
  
Genomic location of solcap_snp_sl_23559  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20511 marker 20511
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)