SGN Marker T1504

SGN-M2052
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAX17TH
Arabidopsis best BAC match: AC007209.5
Arabidopsis position: 2.0750000
Arabidopsis identities: 0.767
Best GenBank protein hit: AAD28668.1
Evalue: 1.4e-54
Identities: 0.652
Description: SNF2 family (CHD1 subfamily) chromodomain protein [Arabidopsis thaliana]
Comment: no experimental data
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39649)
Chromosome
12
Position
118.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1504 was used as an overgo probe on plate 4 [well A4]

Plausible BAC Matches:   P147G13

 Overgo Sequences

A sequence
GGGAGATTTTAGCTGCACACTTCC
B sequence
AGCACCATCAATTGCCGGAAGTGT
AB sequence
GGGAGATTTTAGCTGCACACTTCCGGCAAT
Marker sequence
GCTATCCCGCTGGTGGTTACTAATAAAAGGAAGAAGGGTGGTGATGCTCA
GGAAAGGTTCCCAAAGCGTCGCAAGGGAGATTTTAGCTGCACACTTCCGG
CAATTGATGGTGCTTCCGCTCAAGTGAGAGGATGGTCTTTTGGGAACTTG
TCAAAAAGAGACGCCACACGTTTTTCTCGTGAGGTCAAGAAGTTTGGGAA
TGATAGCCAAATTGACTTAATATCATCAGAGGTTGGTGGGGCAGTTGAAG
CTGCACCAACTGAAGCTCAAGTTGAGCTTTTTGACTCATTGATTGATGGC
TGTAGAGAAGCAGTTAAAGGTGAAGTTGTTGATCCAAAGGGACCTCTTTT
AGATTTTTTTGGTGTTCCCGTGAAGGCTGATGAACTATTGGGCCGTGTTG
AGGAACTTCAACTCCTAGCAAAGCGCATTTCTCGATATGCGGATCCTGTC
TCACAGTTCCGTGCTTTGGCTTATCTAAAGCCTGCAACTTGGTCTAAAGG
TTGT
Genomic location of T1504  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2052 marker 2052
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)