Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1506

SGN-M2053
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAX29TH
Arabidopsis best BAC match: AC011765.4
Arabidopsis position: 1.1407000
Arabidopsis identities: 0.769
Best GenBank protein hit: AAF15934.1
Evalue: 2.6e-55
Identities: 0.769
Description: unknown protein; 89701-90979 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39650)
Chromosome
3
Position
122.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1506 was used as an overgo probe on plate 2 [well A11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCCGGTGAACAATTCGGATAAGG
B sequence
CCAAACACCACCAAGTCCTTATCC
AB sequence
GTCCGGTGAACAATTCGGATAAGGACTTGG
Marker sequence
GGCCTGGTTTAGGTTACTCTGATAGACCTAAGCTTGATTACAATGCTGAT
GTTATGGAAAAGTTTTTGGTAGACTTCATCAATGCTCCTGATAGTCCGGT
GAACAATTCGGATAAGGACTTGGTGGTGTTTGGAGGAGGACATGCTGCTA
CCTTAGCAGTTCGTGCTGCAAAGAAGGGCTTGGTTAAGCCAAAAGCAATT
GCTTCTATTGCTCCCACCTGGGCTGGTCCACTTCCTATTGTTTTTGGAAG
AGATTCCAGCATGGAAACAAGGTATGGTTTCCTTAGAGGGACCTTAAGGG
CCCCTGCTGTTGGTTGGATGATGTATAATGTACTTGTTAGCAATGAGAAA
TCAATAACATCACAATATAAGTCCCATGTTTATGCTGACCCT
Genomic location of T1506  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2053 marker 2053
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)