SGN Marker T1510

SGN-M2055
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TPTAY16TH
Arabidopsis best BAC match: AC007233.6
Arabidopsis position: 2.0300000
Arabidopsis identities: 0.743
Best GenBank protein hit: AAD26909.1
Evalue: 5.6e-76
Identities: 0.743
Description: "putative beta-1,3-glucanase [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49447)
Chromosome
7
Position
56.97 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47381)
Chromosome
7
Position
41.96 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39651)
Chromosome
7
Position
41.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1510 was used as an overgo probe on plate 10 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATACTGACCCTGCTGTGCTCAAAG
B sequence
TCGGATCCAGAAAGAGCTTTGAGC
AB sequence
ATACTGACCCTGCTGTGCTCAAAGCTCTTT
Marker sequence
CTCACCATTTGTCTTCTCCTCTTCGCCTTTTCCTTTTCCCTTTTCTCCTC
CATTGCAGATGCTGGTTCAATTGGGATAAACTATGGCCGTGTAGCTAACA
ACTTACCATCAGCAGTTAAAGTTATAGCACTGTTGAAATCTCAAGGCGTG
GAGCGTGTTAAGGTCTACGATACTGACCCTGCTGTGCTCAAAGCTCTTTC
TGGATCCGATATTAAAGTTACTGTAAATCTGCCTAATGAGCTTCTCTACA
ATGCTGCTAAAAGGCCGTCGTTTGCTTACTCATGGGTGGAGAAAAATGTT
GCTGCTTATTACCCATCCACCCAAATCGAATCCATTGCTGTTGGAAATGA
AGTTTTTGTTGACCCACATAACACAACCCGTTTTCTTGTATCCGCCATGA
AGAATGTTCATCAAGCTCTTGTTAAATTTAATTTCCATGACAAAATTAAA
ATCTCTTCTCCGGTTGCTCTGAGTGCTTTGCAGAACTCTTACCCTTCTTC
AGCTGGGTCGTTCCGATCCGAATTGGTTGAACCTGTCATTAAGCCCATGC
TGGATTTCCTCCGGCAAACGGGATCTTATCTAATGGTGAACTGTTATCCC
Genomic location of T1510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2055 marker 2055
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)