SGN Marker T1511

SGN-M2056
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.04
Tomato EST read: TPTAY18TH
Arabidopsis best BAC match: AL080253.2
Arabidopsis position: 4.1060000
Arabidopsis identities: 0.818
Best GenBank protein hit: BAA01974.1
Evalue: 9.9e-62
Identities: 0.928
Description: chloroplast elongation factor TuA (EF-TuA) [Nicotiana sylvestris]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49448)
Chromosome
3
Position
56.70 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47382)
Chromosome
3
Position
73.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39652)
Chromosome
3
Position
92.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1511 was used as an overgo probe on plate 6 [well G2]

Plausible BAC Matches:   P147J04,   P331I14,   P306O19,   P007M07,   P040F22,   P144J16,   P319F04,   P066E05,   P119H12,   P168H20,   P162N06,   P067H05,   P330A12,   P012I12,   P110C16

 Overgo Sequences

A sequence
CCATGGAAAGACTACCCTTACTGC
B sequence
CGCCATGGTTAAAGCAGCAGTAAG
AB sequence
CCATGGAAAGACTACCCTTACTGCTGCTTT
Marker sequence
GCTCACTCTTATCCTTCTCCGCCATGGCTTCAATTTCAGCAGCGGCTGCC
ACCGCCACTTCTTCTCCTAAGCTCCTAAACCCTTCTAATCCCCTTCTTCC
TTGCGCTGCTAAACCATCTAAGCTTATCCTATCCTCTTCATTTACCCCCA
ACTTTTCTACCCTTCTCCTACACTCACCCGCCGCTACTTCTCCCACCACC
CACCACCAACGCCGCTTCACTGTCCGTGCTGCCCGTGGCAAATTCGAGAG
GAAGAAACCCCATGTCAATATTGGTACTATTGGTCATGTTGACCATGGAA
AGACTACCCTTACTGCTGCTTTAACCATGGCGCTTGCTTCTATGGGTAAT
TCCGCTCCCAAGAAGTATGATGAAATTGATGCCGCCCCAGAAGAGCGTGC
TCGTGGGATTACTATTAATACGGCTACGGTTGAGTATGAGACTGAGAACC
GACACTATGCCCACGTGGACTGCCCCGGTCACGCTGATTATGTCAAGAAC
ATGATTACTGGTGCTGCC
Genomic location of T1511  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2056 marker 2056
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)