SGN Marker T1515

SGN-M2059
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAY42TH
Arabidopsis best BAC match: AC006416.2
Arabidopsis position: 1.0250000
Arabidopsis identities: 0.859
Best GenBank protein hit: AAD18099.1
Evalue: 1.2e-63
Identities: 0.839
Description: conceptual translation. [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39654)
Chromosome
6
Position
69.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1515 was used as an overgo probe on plate 5 [well C4]

Plausible BAC Matches:   P014O14,   P246E15

 Overgo Sequences

A sequence
CAAGAGTCAATGGCTCGCATGAAC
B sequence
GCCAGGAATCCTTCTTGTTCATGC
AB sequence
CAAGAGTCAATGGCTCGCATGAACAAGAAG
Marker sequence
TTCGACATGGATCTTAACCCACCTGCAGGGGAGGACTATGCACACCCACA
GATATGTTTTTTCCATGTGCTCTTCAAGGCAGCAGCATTAGCGTTTTATA
TTCTGTCAGCTTTATTTGTTGATAGTTCTGTTATCATCTTTGTGGTAACT
GTTCTTTTAGCTGCTCTTGACTTTTGGGTGGTTAAGAACGTCAGTGGACG
TATTCTTGTGGGTTTAAGGTGGTGGAATGAAATAGATGACAATGGCGAGA
GTGTGTGGAGATTTGAGTGCCTTGATCAAGAGTCAATGGCTCGCATGAAC
AAGAAGGATTCCTGGCTGTTTTGGTGGACTTTGTACCTAACAGCTGTTGC
TTGGATCTTTCTCGCGATATTCTCCCTCATTAGGTTCCAAGCTGATTATC
TTCTCGTTGTTGGAGTTTGCTTGACTCTCAGCGTCGCAAATA
Genomic location of T1515  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2059 marker 2059
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)