SGN Marker T1516

SGN-M2060
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAY59TH
Arabidopsis best BAC match: AC004077.2
Arabidopsis position: 2.1910000
Arabidopsis identities: 0.641
Best GenBank protein hit: AAC26697.1
Evalue: 3.5e-31
Identities: 0.676
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49449)
Chromosome
2
Position
34.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47383)
Chromosome
2
Position
48.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39655)
Chromosome
2
Position
42.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1516 was used as an overgo probe on plate 12 [well A1]

Plausible BAC Matches:   P023M23,   P123G24,   P226C05,   P040K03,   P129J01,   P245D03,   P264N04,   P248B01,   P288H11,   P050O03,   P134D19,   P163A15,   P029A19,   P001B16,   P060P24,   P122F06

 Overgo Sequences

A sequence
ACACAGGGAAGAGGATTGTTGAGC
B sequence
CCCTTAGCCAAAAGCTGCTCAACA
AB sequence
ACACAGGGAAGAGGATTGTTGAGCAGCTTT
Marker sequence
TCACATTTTTTCATCTTAAACCAACAACATGGAAGGAAGTGAAATCAAGG
AGGAAAAAGAAGCAGGTATTGGTCAGAAGAAGAAAATATTTGTTGCTGGT
GCAACTGGGAACACAGGGAAGAGGATTGTTGAGCAGCTTTTGGCTAAGGG
TTTTGCTGTTAAAGCTGGGGTTCGTGATGTTGACAAGGCTAAATCTGTTT
TACCCGAAGCAAACCCTTTTCTTCAAATTGTGAAAGCCGATGTGACAGAG
GGATCAGCTAAACTAGCCGATGCCATTGGTGATGATTCCGATGCGGTAAT
ATGTGCTACAGGTTTCCAGCCTTCGTGGAACTTGTTGACACCTTGGAAGG
TTAGTCAACTTCAATCCACAAAATAGTAGTATTTACCAGATCCTTCACGC
CTGATCTTGATGATCAGCAAAGTGAGATATTTTGTGATAGGCTTGATGGG
AGTTTCCGTCTCATTTTATGCAATGCAACGTCTTTTCAGTA
Genomic location of T1516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2060 marker 2060
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)