SGN Marker T1518

SGN-M2062
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TPTAY78TH
Arabidopsis best BAC match: AB013392.1
Arabidopsis position: 5.2360000
Arabidopsis identities: 0.488
Best GenBank protein hit: CAA66483.1
Evalue: 2.7e-39
Identities: 0.568
Description: transcription factor [Vicia faba]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49450)
Chromosome
7
Position
19.45 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47384)
Chromosome
7
Position
26.63 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39657)
Chromosome
7
Position
23.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1518 was used as an overgo probe on plate 8 [well F2]

Plausible BAC Matches:   P276F04,   P034K10

 Overgo Sequences

A sequence
TGAGTGCAGCTGAAGAGCTCAATG
B sequence
ATTTGTCAGCAGCTCCCATTGAGC
AB sequence
TGAGTGCAGCTGAAGAGCTCAATGGGAGCT
Marker sequence
GTGGAAATAGGAGAGGAAAAAAAGCGGAAATACCAGTGAGTGCAGCTGAA
GAGCTCAATGGGAGCTGCTGACAAATCCTTCACCCGTCGGCTCAGACGAG
AAGACTGTAAACGCACAAAACATGATTCCTCCTTCTCCCACTGGAAGATT
CTGGTTGGGCCTAATGATTGGGAGGATTATTTATTGGGAAAGGAAGGAAC
AGAGAGATATAGGACTCAGAACCTGCCAAACTGCACCTCCTGCTCTGGAG
GTTATGAACTGGGAATAGCTGTGTCACGACGAAAAGCTGGGCGAGAGGCT
ACCAGACTTGACCCTGATTATATTGTTCCTGTATATGTTGGAAAATCGAA
TAATGTTAGAACTAGACTGCAGCAATATGGACGTGTAGGTGCTCATTTAG
AGAATGACTATTCCAATAGCGAGCTGCACGCTGGTGAAATAATATCTGGT
CCAAAGAGAGCTGGATTATTTACAGAAACATTTTCAAGAGGCTTCTCTAT
TGTTTATAGGTGGGCACCTATGAATGACAATAAAGATGCTGAGAGAACTG
Genomic location of T1518  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2062 marker 2062
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)