SGN Marker T1519

SGN-M2063
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.1
Tomato EST read: TPTAY85TH
Arabidopsis best BAC match: AC020889.3
Arabidopsis position: 1.0879000
Arabidopsis identities: 0.845
Best GenBank protein hit: AAF79700.1
Evalue: 1.4e-71
Identities: 0.845
Description: similar to glutamyl-tRNA amidotransferase subunit B [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41623)
Chromosome
3
Position
14.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43591
Forward primer (5'-3')
TGCACAGACACAAACTGCAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCATAGACAGTTTACAATTGAGCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39658)
Chromosome
9
Position
90.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35606
Forward primer (5'-3')
TGCACAGACACAAACTGCAA
Digested band sizes (using HincII)
Solanum pennellii LA716: 466
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CACCCTGGTAATGCCAAACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 466
Solanum pennellii LA716: 466
Approximate temperature
55°C
  
PCR data   Exp. ID 119
Forward primer (5'-3')
Unknown
Digested band sizes (using HincII)
Solanum pennellii LA716: 466
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 466
Solanum lycopersicum LA925: 466
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1519 was used as an overgo probe on plate 14 [well F11]

Plausible BAC Matches:   P102E23

 Overgo Sequences

A sequence
GTGGTGGCTATCTTGATGTGGATC
B sequence
CCATACTCGAGTGGAAGATCCACA
AB sequence
GTGGTGGCTATCTTGATGTGGATCTTCCAC
Marker sequence
GGAAAACAATGGGGTTTTGTATTGTTGTATGAGAAGTGCACAGACACAAA
CTGCAACCCAAGAAAAGGAACAGACTAAGTTGAAAGTTTCCACTCAAAGC
CAACCTAAAGCAGTTGATAAGTTTCTGAAGGATTTTGAGGCAGTTATAGG
GATTGAAACCCATGTTCAACTTTCCACTCTCACTAAGGCTTTTTGTAGCT
GCCCTTATAACTATGGTTCTCCACCTAATACCAGCGTTTGCCCTGTTTGT
ATGGGTTTGCCTGGTGCATTGCCAGTCTTGAACTCAAAGGTGATAGAGAG
TGCAGTAAGAGTTGGCCTTGCACTTAATTGTAAACTGTCTTTGAATTCTA
AGTTTGATAGAAAACAGAACTTCTATCCTGATCTTCCCAAAGGATATCAA
ATATCACAGTTTGATATCCCAATTGCTAGTGGTGGCTATCTTGATGTGGA
TCTTCCACTCGAGTATGGCGGTGGCCATAGAAAGTTTGGCATTACCAGGG
TGCATATGGAAGAAGATGCAGGGAAGCTGCTTCATACCGATGGGGGGAGC
TACTCACAGGAAAGAACTCCTTTATACTTAAACATTCACATGCTC
Genomic location of T1519  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2063 marker 2063
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)