SGN Marker T1522

SGN-M2065
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAZ06TH
Arabidopsis best BAC match: AL031326.1
Arabidopsis position: 4.1200000
Arabidopsis identities: 0.781
Best GenBank protein hit: CAB79299.1
Evalue: 2.2e-54
Identities: 0.781
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49452)
Chromosome
8
Position
61.49 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47386)
Chromosome
8
Position
93.69 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39660)
Chromosome
8
Position
75.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1522 was used as an overgo probe on plate 12 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCTTTGAGGAGCAAGAAGAGGCT
B sequence
TAACCCTAGCTACAGCAGCCTCTT
AB sequence
AGCTTTGAGGAGCAAGAAGAGGCTGCTGTA
Marker sequence
GTCTGGGGAACCAGTAATTGGCAAGACAGATCTACTGCTTGAGTATGCTT
ATCAATTTCATCAGCGCTACAAAATGGTCCTTTGGATTGGAGGTGAAAGC
AGATATGTTCGACAAAACTACTTGAACTTGTGGTCGTTTTTAGAAGTTGA
TGTCGGGGTAGAAAACTCACCTGATAAAAGCAGGATAAAGAGCTTTGAGG
AGCAAGAAGAGGCTGCTGTAGCTAGGGTTAGGAAAGAACTCATGCGAGAC
ATTCCATTCTTGCTGATAATTGATAACTTGGAGAGTGAAAAGGACTGGTG
GGATCATAAACTAATAATGGATTTGCTTCCCCGTTTTGGGGGTGAAACAC
ATGTTCTCATATCCACGCGCCTCTCTCGGGTTATGAACATGGATCCTATC
AAACTCAATTAT
Genomic location of T1522  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2065 marker 2065
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)