SGN Marker T1526

SGN-M2069
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAZ31TH
Arabidopsis best BAC match: AB018109.1
Arabidopsis position: 5.1980000
Arabidopsis identities: 0.813
Best GenBank protein hit: BAB08671.1
Evalue: 2.4e-51
Identities: 0.789
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39663)
Chromosome
6
Position
10.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1526 was used as an overgo probe on plate 3 [well G8]

Plausible BAC Matches:   P164O02,   P117E11,   P195O15,   P107J04,   P038B20,   P261K12,   P048M24,   P128I11,   P269P20,   P033B19,   P157O23,   P157I14

 Overgo Sequences

A sequence
ATCTCCACCGGAAAACTTGGATCG
B sequence
CTTGGTATGCAGGTGACGATCCAA
AB sequence
ATCTCCACCGGAAAACTTGGATCGTCACCT
Marker sequence
AGAAAATAAAGTTATATTTATAATACTAAAAATTGTGAATGAAAAATTTA
CTGATCAAGTGCATTAGGCCCAGTACAATAATTCACAACATGATTCCACA
CCCACTGAACCAAAAACTTTCTTCTTATTCCATTCATATTGTACGTTGCA
CCATCTTCACCGTTCAACATTTGCCCAGTATACGACCCACCACCACCCGA
CCCATATATCCCTTTACAAAGATCCCCTATCTCCACCGGAAAACTTGGAT
CGTCACCTGCATACCAAGCATTCACCAATGGATTCGTTGATAACTCAGCA
ATTTCATGAGCAATCACACTAATCATTCCGTCAACACCCACATCGTTATT
CGGCGATTTCACAGCTTTGAAACCCCGACCCATGTAATCGGGTACGGAAA
ACGGGTATGCACAAACACTGGGGCATAGTTTGCCGGAGTTACCTACCCAT
GC
Genomic location of T1526  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2069 marker 2069
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)